Sunday, March 31, 2019
Complete draft dissertation
Complete draft dissertationChapter iodineIntroductionMusic ordure extract several(predicate) responses because of the style its substance communicates and gives meaning to peoples lives. Ned Rorem stated, medicament is the sole guile which evokes nostalgia for the future day (S humans 1997 140). The medical specialty icon is testimony to the way in which old melodious writing styles construct each provoked a sen timental nostalgic response in lacking(p) to chief(prenominal)tain and bear on a traditional sound, or a hardheaded yeasty personic productionistic response which chooses to use the memory of an old melodious inwardness and sound to inspire new, creative innovations. gypsy dancing is no exception. Throughout its tale in that location atomic number 18 those who use up sought to encase it, partakering to it with nonions of romance and sentimentality, and those who sire embraced its evolving nature. The first is real of intellectualists F complet elya and Lorca, who sought to preserve cante jondo -the cabalistic metrical com stake of the outcasts by hosting festivals strictly for traditional machinationists to display its purity. It is withal unequivocal in the draw of the rising middle classes in Andalusian cities toward the tragic margin c either of gypsy dancing. gypsy dancing provided a romantic perspective of the quondam(prenominal), a folklore-like history to provide a distinctive identity for Andalusians, also allowing them to express their sympathy for the garbage downtrodden. The poor, for their variance, embraced the romantic tenor style of gypsy dancing because it show their anguish, and also allowed them in hindsight to abide a rosier slant on their mis whileble outgoings holding out a hope, veritable(a) so faint, that the sincerity of their variant would qualify them as bonifide cultural heroes in the future (Washabaugh 1996 55). Since gypsy dancing evokes ancestral history, the art make f or can encase and preserve these memories, scarce to re-live them d peerlessness melancholic sentimentality. Conversely, Vlez suggests that the pleasures of the past are non lost to the present tense, noneffervescent are trans radiation diagramed into radically different esthetics by the manifold forces that operate d iodine time (Vlez 1976 25). This approach recognises the contributions of the past that keep giving to the present, allowing the process of musical organic ontogenesis to keep an art form animate and developing. In this way, each generation builds new pleasures on top of old, and adds fresh memories to existing recollections (Feathers net tone 1991 32). This is aline of novel gypsy dancing mechanics, who research to recognise their roots, while introducing their own interpretations and in truth much experiment with other musical sounds. Globalisation has meant that the product of this approach is seen in a fusion of elements with very(prenominal) d ivers(prenominal) musical styles. Modern flamenco fusion band Ojos de Brujo package this approachFlamenco is in most(prenominal) a(prenominal) places and it can evolve in many ways we draw from the alike(p) source and we have the equivalent love and the same respect for this music(Flamenco World 2002).This dissertation lead examine the main perceptions of flamenco an older, traditional perspective that views flamenco as dead and a nonher younger perspective that argues flamenco is still a vibrant and reenforcement art form. It exit account for aspects indoors the wild debate over flamencos historical purity, studying how it has remained a constant, changing and evolving art form. Chapter Two will examine the purity of the history of flamenco, considering the four main perspectives by means of which it has been viewed. Chapter Three studies the significance of the message and emotion characterising flamenco, and the way in which the song forms serve as a window into the lives of the flamenco friendship. It also accounts for the fact that though traditionalists contend for one pure song form, at that place are in fact many branches within the genre. Chapter Four describes the travel in the modernisation of flamenco, considering how traditionalists blame this era for the degeneration of flamenco, whilst modernists praise it for its progress. Chapter five analyses the two groups that have emerged in the flamenco scene, the purists who insist that true flamenco resides in the past, and the modernistswho style embrace the evolution of the art form.Chapter TwoThe history of FlamencoFlamenco holds many threads of history. Depending on who is narrating its past, the proper and true history of flamenco can be implant in various long-lived and widespread claims. Washabaugh identifies four main ideologies held by flamencologists Andalusian, Gitano, Populist and sociological (Washabaugh 2006 32). This chapter will consider the debate over the purit y of the history of flamenco and examine the four main varying perspectives through which its origin has been viewed.The tie of ideology emphasisng the Andalusian character of flamenco music conveys its doubtfully-rooted and cultural musical characteristics that formed by Andalusias unique history and demographic make-up that created the conditions which birthed a very distinct art form. Unlike the constructions of Spanish nationalism, especially in the Basque and Catalan regions, Andalusian identity was not predicated on the notions of racial purity, Andalusias unique identity was often bad-temperedised by the very multiplicity of cultural and racial layers from which it had evolved(Brown 2007 230).Contributing to this melting destiny, the 800 year reign of the Moors tolerantly allowed other diverse finishing groups to cohabit within their society Arabs, Jews and Catholics all contributing to the rich mix found in multicultural southern S incommode. However, the Christian Re conquista in 1492 brought a new era of hostility to the region, driving out all Jews and Muslims who refused to convert to Christianity, alongside gitanos who refused to conform to sedentary occupations. This expulsion united the persecuted cultures against the Inquisition who now shared a muliticultural common life. An intense blend of Muslim, Jewish, Indian and Christian cultures characterised these underground communities, producing a fusion of distinct musical sounds which formed what we now call flamenco, here, in the midst of the minorities. And there it stayed, performed in the privacy of their houses or caves unknown to the human macrocosm until the end of the eighteenth century when it began to be heard in the taverns and other universal places (Totton 2003 15).There is a vivid debate between the gitanos and payos over the origin of flamenco, both(prenominal) people groups insisting on their contribution collect to their cultural bonds. The majority of non-gitanos do not deny the role of the gitanos in the enriching and developing process of the flamenco art, but they are very sheer(a) when it comes to the origin, Andalusia (Papapavlou 2003). Many composers and philosophers such as Manuel de Falla were keen to preserve a musicological perspective that contributed to a Spanish identity based on the romanticism of Andalusias origins as a primitive artefact. Writers and philosophers diverse assertions of a distinct Andalusian identity give varying emphasis to oriental music through Indian (the gitanos place of origin) and Arab roots, Sephardic Jewish music, as well as influences as far back as the early Greek, Roman, Visigoth and Byzantine rulers. These concepts are all based on the diverse musical influences that can be traced in the flamenco cante, baile and toque its very un-Western chant like melodies and long melismatic wails, its rugged twelve-count comps which provides a driving underlying rhythmical structure with syncopate accented golp es, as well as the exaggerated upper be movements and stamping zapateado created by the bailaor. Altogether these speculative transferring influences are said to play a part in the evolution of flamenco. These claims also contain cultural connotations that provoke issues of race and identity, which prove to shape Spanish cultural consciousness and identity. In this way, the anthropomorphised Andalusia passionate, musical, changing, and anarchical- had become the true source of flamenco (Deutsch 2004 220).Though Lorca contends that flamenco has to do with a purely Andalusian canto which existed in embryonic form onward the gypsies arrived, others think that flamenco is the heathen music of the gitanos (Steingress 2003 154 quoting Lorca 1984). The active participation of the gitano community created a phenomenon by virtue of their extraordinary facility for adaptation which brought the diverse cultures of Andalusia finally into harmony (Leblon 1994 72). Cante gitano refers to the songs that expressed the pain of the gitanos under persecution. They were kept alive underground and performed in the gitanos notorious family gatherings and fiestas where the atmosphere was conducive to spontaneous song and dance. These proceedings were so intimate that the distinguishing lines between audience and doer were blurred. Their strong literal traditions and gritty songs of old provided a strong identity amongst the Andalusian gitanos, the campaign why writers such as lvarez Caballero believe they were nothing short of the blush movers of flamenco (Caballero 1988 70 Washabaugh p.34). To many, therefore, the word flamenco has become a equivalent word for the gitano. This is helped by the fact that thiscommunity is still a very visible sector of society. Although historically by the nineteenth century the gitanos were now an integrated part of Spain, they represent a people group with a uniquely fork racial status, while still forming an integral part of Andalusia n culture (Brown 2007230). The gitano perspective is not without criticism, however, and there are debates about attributing the entire invention of flamenco to the gitanos, some flamencologists even questioning the very nature and inherent aptitude of the gitano to be competent to create an art form. Ruiz, amongst others, believes that the gitano by nature does not create, but assimilates and integrates, contributing, rather, his influence in this way (Ruiz 2007). Similarly, Totton believes that the gitanos did not engender their music to any country they settled in. Instead, they adopted the music of that country, adapting it to their own situation style of musicality, their strong rhythmic sense, and their tendency to dramatise. In this way he believes that the gitanos have been the catalysts, but flamenco developed in the melting pot of Andalusia (Totton 2003 14).Others believe that the origins of flamenco matter not, and that flamenco is not just the music of southern Spain but forms a way of life that influences the daily activities of many southern Spaniards. Moreover, one does not have to be a performer of flamenco to be a flamenco. A flamenco is anyone who is emotionally and actively involved in this unique philosophyan outward expression of the flamenco way of life (Pohren 2005 9). This ideology is also held by the populist mention of view which sees flamenco as a voice of resistance. Instead of emphasising its ethnic origins, flamenco primarily is seen to have been used as a mean by which to express an outcry from the conditions of oppression in which marginalised people found themselves. This account merits these oppressed artists as the creators of flamenco, their cante jondo marked by a deep and moving performance brought to life by duende. For Lorca, the supernatural force of the duende enters human beings and possesses them as they create inspired, deeply moving work (Hayes 2009 40). A performance which lacks the essence of duende would b e considered as shallow and unpure a common care of the flamenco purists of modern, more commercial, performances. This populist account suggests that the flamenco style persisted in Andaluca for nearly 500 years. However, during the nineteenth century that resistant song of the lower classes began to lose its bite with the commercial developments of the art form (Washabaugh 1996 36). calm down others argue that the spirit of duende continues. The sense of Andalusian oppression has been a key theme in flamenco, and the present political freedom and crisis of mass exile have, if anything, intensified the use of flamenco as a vehicle of well-disposed commentary both through text content and, less overtly, through stylistic innovations(Tong 1998 176). The sociological perspective is that flamenco is a phenomenon that brings classes together, and disagrees with many populists sagacity of the degrading transition flamenco went through in its commercialism. Flamenco remained a voic e of the lower classes though it became fashionable and began to be heard by the upper classes in the golden age of the cafes cantantes. It was on this stage that performers were able to vent their tragic past to their audience of wealthy oppressors. Washabaugh explains that the song, on this account, performs a double catharsis, exposing and relieving both the pain of the poor and the guilt of the wealthy (Washabaugh 1996 36). In this way, flamenco is a means of connecting both sectors of society as both poor and wealthy can walk away from the performance psychologically unburdened by the awareness of their different friendly standings. Focussing on the sociological history of flamenco, this perspective coincides with what is exposit as the second undulation of the genre, a time when flamenco embarked on a process of what Biddle and Knights endpoint as re-Andalusianisation, finding its identity in both a topical anaesthetic and global dynamic (Biddle and Knights 2007 14). Tho ugh this point in flamencos development is disadvantageously criticised by flamenco purists, for sociologists it was here that flamenco truly came into being, reaching the popular scene, and finding its Golden Era. In this way, some authors believe there is no point in searching in the distant past for origins or a genre that really did not come into being until the middle of the last century (Leblon 199477).Upon upbraiding, the tradition of flamenco has not enjoyed the same faithful written record as other determinate forms (Hayes 2009 53). The origins of flamenco seem likely to remain shrouded in mystery for some time to come, due to the circumstances surrounding its birth and musicologists unwillingness to tackle the question. As long as the exactly efforts made in this field have as their sole aim the ruthless elimination of a condition community from the competition, there is no chance of our knowledge progressing(Leblon 199473). To conclude, this chapter has exposed the d iscrepancy in the historic accounts of flamenco, and the ideologies that have emerged from four different perspectives. It is therefore evident that flamenco has not followed a pure linear history, but has encountered many different components equally subjective to the process of its creation.Chapter ThreeThe Voice of Flamenco in SocietyFlamenco has been described as a way of life, a way of perceiving and interpreting daily existence (Martinez 2003 5). Its central position in its communities distinguishes the art form from many other musical genres, and only in understanding its voice in society can one appreciate the passion that flamencos feel for their music. This chapter therefore sets out to discover the significance of flamenco and its legacy by studying the messages that its song forms carry, which serve as a window into the lives of the flamenco community. It will also examine the splendor of individualised expression channelled through the three musical elements of flam enco cante, baile and toque. furthermore the chapter accounts for the different subdivisions of the genre, also suggestive of the fact that there is not one pure form of flamenco but many branches that serve as a reflection of different flamenco communities. Though there is oft discussion concerning the exact origins of flamenco, it is evident that, at first, it was an art form in the hands of the minorities. There are many song forms within flamenco that serve as a window into the lives of these communities. Flamenco was a reflection of tender life, engaging not only with universal themes such as love or death, but also referring to religious and political issues bear upon personal life. Many have examined the way in which the community expressed their ways of life through flamenco lifes pressures, work conditions and the inequality of power structure in labour, social structure, and social divisions. En este aspecto, la desigualdad es el eje vertebrador del cante a travs de di versas temticas que, aun referidas a lo universal, al amor, a lo panhumano de la muerte o el dolor, estn siempre socializadas traspasadas por una experiencia cultural no abstracta ni confundible con otras la andaluza(Roldn 112).Flamenco palos, or song forms, convey these themes, many flatly giving emphasis to one theme in particular. For precedent, amongst many, Carceleras are prison house songs, albores are gypsy wedding songs, and mineras are miners songs. Other song forms emphasising a more general theme accentuate a peculiar(prenominal) musical element of flamenco the cante, toque or baile. Flamenco in its true form was only cante, a primitive cry or chant accompanied only by the rhythm which would be vanquish out on the floor by a wooden stave or cane. These styles are known as Palos Secos and they are the oldest forms of cante known today. These including the tons, and the saetas, religious songs thought to be of Jewish decent used during processions, improvise without any accompaniment. Other palos are in a higher place all rhythmic which have also given rise to leading dance forms, such as the sole, and bulera. In the revelation of these mostly tragic song themes, it is weighty to convey the difference between flamenco and western music, primarily in the way in which, in the west, one hears the tune first, and then only then, perhaps, the harmony, rhythm and words. To the flamenco, the tune is little or nothing, and the harmony less, being aware, above all, of the words and their rhythmic and firm expression (Totton 2003 84). Flix Grande has defined flamenco as a tragedy in the first person and a protest without hope or destination (Grande 2007). The siguiriya is an example of this concept, the heart of cante jondo. It expresses anguish, lament, and despair, and has been described as an outcry against fate and quintessence of tragic song (Totton 1995 90). It is an example of how the transmission of song serves as a window into the lives of th e flamencos. The following copla from a traditional siguiriya is an example of how the history of these Andalusian communities is communicated through the art formSeor Alcalde mayor Lord high mayorY dems seores And other fine lordsEstas penitas a este cuerpo moThe pain in this body of mineNo le corresponden Is not merit(Kirkland 2001 9)Felix Grande would respond to such an example by saying Listen nigh to a ton, truly hear a seguiriya let some tientos slide through the hairs of your arm. Perhaps you will sense something resembling the hand of Philip V signing a paper in 1745- surely without trembling- to authorize those engage a Gypsy to enter a church and take him from its protective cover (Kirkland 2001 9).The striking imagery and emotional purity of cante lyrics is also evident in the following coplasEl tiempo y la mareatodo me viene en contralos golpecitos de este mar furiososalen por la popa( 94).Hasta las piedras saben la desgracia maque yo las vendo -mis desgracias-de n oche y de da( 95)On one level, the coplas serve as a descriptive reflection of the lives of the flamencos, and on another, serve as a representation of complaints, hopes and vindication. El flamenco sirve mirror symmetry descubrir la realidad, para exponer las formas de vida y hasta cuadras de costumbres, pero tambin para reflexionar sobre ellas y denunciar las desigualdades. Pasa de lo descriptivo a lo analtico sin saberlo, y a veces a lo crtico(Roldn 112).It is therefore evident that the role of flamenco in society is not merely aesthetic, or for ephemeral enjoyment, but that it has become a backing testimony of the flamencos themselves, and an outlet for emotional unburdenment. No canten, pues, con el nico objetivo de hacerlo mejor que la vez anterior o mejor que otros cantaores cantan porque es genus Sus propias carnes o en las carnes de su propio grupo social o clase han padecido marginaciones y atropellos que a su vez se convierten en exponentes y portavoces de sus propios grupos, familias o entornos.(Gelardo y Belade 21) This is also suggestive of the reason why purists seek to protect the purity of this expression. Clemente believes that dealing with cantes, palos, comps, and melody is like dealing with living beings, they deserve the respect involved in keeping them alive (Clemente n.d). This reveals an ingrained link between the lyrics and expressive aspects of the music. Early developments of flamenco show that the socio-political balance of the art form is manifested in both these facets. Pohen (1995) believes that it can not be overemphasised that flamenco, above all the jondo flamenco, is in essence an emotional art. Moreover, the artist require only enough technique to enable him to convey his emotions to himself and to his publicThe better of technique to the point of virtuosity is not usually synonymous with the improvement of the artists ability to communicate. Conversely, the opposite is more often true. The virtuoso often becomes a c old machine, too concerned with his technique, too complicated, too involved in his own virtuosity, too conscious of the fact that the majority of the public is awaiting this virtuosity more than any duende he may impart (Pohen 1995 58).This emotion is interweave through the cante, baile, and toque, each embodying the rhythm and expressive force necessary to bring the words of the coplas to life.The cante is said to have been developed in isolation by Andalusians, and especially gitano Andalusians, and which redeems humans from the prison of language and the darkening isolation of social life (Washabaugh 1996 90). The flamenco cantaor recreates and embroiders the song form in a personal way, expressing to the audience what the words mean to him (Totton 2003 84). The quejo, melisma,the manipulation of the comps, and the quality of voice itself are ways to enforce the power of the cante. The cantaor also adds emotion by ad lib weaving his voice around the words, envoking duende. Th e intensity of the cante means that many cantaores like to sing al golpe,accompanied only by knuckles on the tabulate and the cries of encouragement from the jaleo. The baile also takes on the character of the coplas by concentrating on forceful rhythms. This contrasts from the graceful movements given importance by modern music academies, a feature of modern flamenco also criticised by purists. Prejudices run deep on the subject, and the Spanish language marks the difference the classically expert dancer (whether or not also dancing flamenco) is a bailarn the flamenco dancer is a bailaor or bailaora (Totton 2003 51). Pure flamenco baile is anticipate to be individual, forceful, downward, and introvert. A similar prejudice has been established between classical guitarists and a true, flamenco tocaor. The difference can be seen in the very way the guitar is held to the emotional way the tocaor marks out the rhythm and comps through plucking, strumming, tremolo and banging the woo d, and also the ability to improvise, adding his own falsetas.Toca de odo, por intuicin, improvisando continuamente, y aporta, como productos de cosecha propia, las falsetas (Ruiz 2007 90).Though the toque element was introduced later on in the evolution of flamenco song forms, it is still seen to be an important element.La gran originalidad de la msica flamenco de guitarra se resume en el hecho que los elementos meldicos, armnicos y rtmicos que la componen tienden a inferirse en provecho de un elemento expresivo winner que engloba y enriquece a los dems y que podra calificarse de dinamismo(Hilaire Ruiz 2007 91)Uniting all elements of flamenco, lyrical, musical and emotional, is the strong sense of tradition and heritage manifested in the art form itself. In this manner, flamenco receives and keeps giving back its communities, allowing the flamenco legacy to live on. It is important to note that until recently, music and lyrics were never written down but transmitted orally. Comp ositions from the past have been handed down through the generations, and the extensive categorisation of palos reveal that there are many branches of flamenco, originating from legion(predicate) communities from different parts of Andalusia and further afield, all adding their musical flavour and history. These branches can be as contrasting as the discussed traditional tragic siguiriya and cante jondo to the cantes de ida y vuelta which were exported from Spain to the New World where they acquired new influences, later to be re-imported again to Andalusia by returning emigrants. These contribute to the rich diversity of song forms which have evolved from the original palo seco to varying rhythmic song forms which incorporate baile and toque, two main elements of flamenco that were integrated later on in the evolution of flamenco. Throughout the evolution of flamenco song forms, purists insist that the ablility to evoke duende distinguishes the true flamencos from modern, experime ntal musicians, due to their ability to identify with the anguished themes of the cantes, re-living these emotional experiences. This chapter has discussed the role of flamenco in society through analysing the dual function of the art form. Firstly, it is evident that the genre transmits the history of a marginalised people through the coplas. Secondly, and entwined with the first, is the expressive, mainly painful, release of emotion associated with life experiences through the three channels of flamenco cante, baile and toque. In this process, the evoking of duende is what sets flamenco apart from other musical forms, and is suggestive of the purists insistence of protecting a traditional and pure music. However, the many branches of musical style within flamenco also alerts one again to the fact that, though flamenco demands a purity of emotion, there is not one pure song form and single history within the genre, but many stories with diverse themes and musical influences, inevit able in an art form of oral tradition.Chapter FourA New Era of FlamencoWhen evaluating the different phases of flamenco, flamencologists have tried to define the time line into conveniently identifiable eras. The stages flamenco has passed through until the present day are identified by the venues where it was staged, as well as the artists who were most popular at any given moment (Martnez 2003 66). Biddle and Knights (2007) refer to these historical stages as waves, while Steingress (2003) refers to them as steps of hybridisation, both studies highlighting exhaustive influential causes of change undergone by flamenco. The phases which have contributed to the modern evolution of flamenco are important to highlight because of the way they have changed the face of flamenco, both musically and culturally, not only adapting its sound but its audience also, taking it from the primitive privacy of the juerga to the very public showcasing platform. This chapter will examine the stages mar ked by three main venues that changed the image of flamenco the cafs cantantes (1860-1920), the theatre which hosted pera flamenca (1920-1950), and the tablaos and peas (1950-1975). Through describing their effect on flamenco, the chapter will also study the way in which these periods have provoked a debate which accuses this period of evolution of either the degeneration or make of the art form. The study will account for the perspective that, whilst many look to the past to define flamenco, the genre has encountered many different components equally indispensable to the process of its creation. The cafs cantantes laid the groundwork for what has been termed the Golden Age of flamenco. Having only existed as a way of life, little by little flamenco gained popularity, and by the middle of the last century, sharp businessmen realised that flamenco could be exploited profitably in commercial exercises (Pohren 1995 146). Flamenco was introduced as a public attraction and customers flo cked to witness the novel presentations of the flamencos who complied to life as a paid artist and higher standard of living. One of the things that the caf cantantes achieved for flamenco was to broaden the range of non-gitano performers who were willing to make crowd-pleasing innovations and modulations, as neither the payos nor their audiences had sort of the same distaste for broad popular appeal (Drummond 2006 168). Those who performed in the cafs naturally followed the tastes and whims of the customers and it is argued that thistrivialised flamenco, since patrons requests favoured festive rather than deep flamenco performances (Hernndez 2008 15). Furthermore it is contend that this enforced a staged professionalisation inspiring competition amongst performers, not a feature of flamencos emotive purity and unconcern for virtuosity. The guitar, in particular gained eminence in caf performances and, from being an instrument to accompany song and dance, it became a show in itsel f, and solo guitar performances soon became popular favourites (Hernndez 2008 15). In addition, artists from the different provinces of Andalusia contributed to an enhancement of flamenco by elaborating their regionally distinctive substyles (Washabaugh 1996 33). An important artist to emerge from this era was Silverio Franconetti, a non-gitano who opened his own successful caf cantante, and is amongst a group of flamenco legends to emerge from this era. His legendary fame for contribution to the flamenco scene, even recognised amongst gitanos themselves, however, is ironically criticised. This accounts for the parody of the Golden Age. On one hand, condescension for the beginnings of crass commercialism, and on the other, an excitement for the new wave of creative and technical competence. Nevertheless, in the light of the modernisation that was to come, many pure artists were still able to enjoy the profit of this time, being able to make a decent living from what they loved most. Desperate to preserve tradition in the threat of modern change, Spanish Intellectuals Manuel de Falla and Federico Garca Lorca attempted to revitalise the true and pure spirit of Andalusian flamenco by promoting the Concurso de Cante Jondo in 1922. They spurned the name flamenco, embracing the term cante jondo in order to deliver interest in uncommercial styles of flamenco which were in decline. However, the initiative could not prevent the second wave of modernisation which replaced the cafs cantantes with
The National Drugs Campaign Media Essay
The National Drugs Campaign Media EssayThe National Drugs Campaign (NDC) was created by the Australian Government to decrease the dose engross amongst the Australian population. They lose through this purpose by sp enjoining nurture closely the dangers of drug role and encouraging the in the public eye(predicate) to abstain from drugs. A bunk has been launched since 2001 for this movement, which included 4 phases to be launched at different times within a decennium class span. It is one of the longest- manoeuvrening public education track downs on outlaw(a) drugs in Australia.Although illicit drug usage may be decreasing collectable to NDCs bleed, fervor usage remains stagnant. According the Mental Health Minister, Helen Morton, The modish National Drug Strategy dwelling Survey showed 4.1 percent of westward Australia survey separateicipants had employ go in the past year, similar results to 2001 and 2004 (Morton). In fact, according to the National Drug and Al cohol Research Centre of Australia, ecstasy has been used by near 8% of the entire Australian population, with approximately 3% having used in the preceding 12 months. (Ross).In localize to cut out these statistics, the NDC fuck offed a new persist targeting ecstasy in January 2011 called the ictus. typesetters case Facts campaign. I bump that this was a successful approach to use in order to fulfill the needs of their overall campaign. One of the NDCs main objectives is to reduce illicit drug usage, and since ecstasy was not in decline, it yet makes common sense to focus the next campaign particular propositionally on ecstasy.As part of their communication model, they created objectives of this particular campaign. These includes increasing the knowledge to their audience about the unsafe facts of ecstasy, reducing the usage of ecstasy and early(a) illicit drugs these users may project tried, preventing anyone from ever trying illicit drugs, and supporting them to r efrain from any drug usage. The NDC released several public assistant announcements, which was their entire campaign, in order to advertize positive consumer behavior. According to the National Drugs Campaign, there be four overall hearts that need to be conveyed to the audience. These messages include the following in that respect are specific risks and harms associated with utilize ecstasyThere are real risks and harms associated with using illicit drugsThere are real benefits to not using ecstasy and new(prenominal) illicit drugs andThere is a range of information available on the facts about using ecstasy and other illicit drugs.The communication channel of this government advertising campaign consist of integrated media activity with tuner, bell ringer, outdoor, online, and in-venue advertising, public relations and promotions, and information resources such(prenominal) as National Drugs Campaign website (australia.gov.au/drugs) and the 1800 250 015 information line. S ome public relations activities include sponsorships of theIn The Mixwebsite, prevalent radio programs on Nova FM and Austereo, the Future Music Festivals, theRock the SchoolsandI Am With The Bandinitiatives and National Youth Week 2011.The communication bring in which to reach NDCs target audience is an important factor to get their message across. I feel that the chosen mediums of advertising, specially through print and radio, are a fast and easy way to reach a mass audience while still pussbing the attention of the target market. Having online tools such as the website, and interactive in-venue advertising a desire incorporates new ways of arrive at and communicating with the youth of Australia, which research shows us is how they want to be cognizant of these issues. Finally, having PR activities that include sponsorships that young people idolize and are long-familiar with will help to better relate to them. Youth marketing and public relations activities that are ali gned with music further engages youth in ways that are meaningful to them.It was also an important decision that the NDC chose to use print media other than television to get their point across. They chose to advertise more than in magazines that teenagers would read, such as Cosmopolitan. This way they would reach their target audience. They also were able to gestate a more personal impact on their viewers through their ocular communication. The entire layout of the advertisement, including the typography, pictures, and colors were all effect together meticulously. Since there is only a few moments before the onlooker of the ad decides whether or not they will continue reading, it needs to consider all aspects of the print to be attention-grabbing, which it is.Research conducted by drug and alcoholic drink experts and the Australian National Council on Drugs led to the development of the target audience. It was intractable the campaign would target the youth aged 15-21 yea rs who are at risk of using ecstasy and/or other illicit drugs and parents of 13-17 year olds. According the research conducted by the National Drug Strategy Household Survey, 38.1% of Australian over the age of 14 had tried illicit drugs. . This is the central transition time in young peoples lives. Since they are highly influenced by their environments and their social stimuli, they are more at risk. Since teenagers in Australia are using drugs at such an early age, the target audience should be 15- 21 years, and it is also necessary for parents to start worrying about the safety of their children as well. Thus, the target audience for the advertisements is a logical age.Before the advertising campaign was made, a yeasty brief was formed which highlighted the consumer insights as well as the creative strategy that NBC would use. Formative research was conducted with people aged 12 -25 to explore youth attitudes and behaviors to illicit drugs. They examined positive and negative perceptions of drug use, paint drivers and barriers to trial, and identified effective channels with which to communicate with young people in relation to drugs (National Drug Campaign). The research results indicated that young Australians had previous knowledge mingled with the image or specific drugs and perceived personal effects of them. These finding support NBC to target communication about particular drugs, rather than simply sort out all drugs together. This research also identified different segments of young people, define by clusters of particular attitudes to drug use and their lives, which drive home been vital to the provision of the campaigns creative strategy (National Drug Campaign).Two main visuals that suck been used in outdoor advertising such as peckers and billboards are called the tape drive female child advertisement and the go game science lab advertisement (National Drug Campaign). The Ecstasy girl features a visual of a haggard, disheveled g irl who looks like she is clearly a drug user. The caption above says Insomnia, memory loss, or psychological problems. The second advertisement features an ecstasy lab which consists of a visual of a repulsive bathroom and tubes attached to the inside of a buns going into beakers. These beakers imply that the drugs are made in this kind of setting, with recondite contents. The caption above reads Made using drain cleaner, battery point or even hair bleach. indeed popped in your mouth. The second of these advertisements is more widely known, and the message of the contents of ecstasy was used in other forms of media such as video and radio.The cultural setting of the Ecstasy Girl advertisement is an illustration of all teenagers. Though it may show a young, blonde, Caucasian women, it still repre displaces all of the youth that is having problems due to drug usage. It is a physical depiction of the entire target audience. Even the Ecstasy Lab advertisement with a picture of a la b may only show the setting of one place where the drugs are made. However, it is still a physical depiction of what contents go into ecstasy, and illustrates that the contents of drugs are never pure.In the fourth stage of the communication model, the message that is being sent is interpreted by the audience. The way that teenagers would interpret these public service announcements is critical to make sure the objectives of the NDC are being met. Thus, in order for these advertisements to have any impact on it audience, it needs to pass the hierarchy of effects model. This means it needs to stimulate their attention, interest, desire, and action. I feel that this advertising campaign does create attention since the visual depictions are both extreme and invoking. The colors (yellow, blue, white) are eye-catching. Even the font they use for the words is large and capitalized, demanding attention. By reading the copy, the audience would then gain interest, since the copy in the adver tisements is thought-provoking, harsh, and blunt. Then they would look at the pictures again and associate with the words to realize what the message is trying to convey. When they finally put it all together, it would create the desire to get a line to the message, and abstain from trying drugs, which is the action that the NDC is trying to invoke.Since the National Drugs Campaign is run by the Australian Government, it is government advertising which is a public service that promotes good behavior. It is not in competition with other brands or companies. However, it does have other organizations that support the campaign, even if they have their own strategy for trying to decrease drug use. For example, Drug Aware, a drug prevention program in Western Australia took its own approach to handling the ecstasy escalation in their region. Instead of using print advertising, they did everything online. They created a new youth-oriented ecstasy campaign website interface on the Drug Awa re website, where visitors can watch videos featuring the Ecstasy experts, read up on the facts, or chat live and confidentially with a qualified drug counselor (Drug Aware). Other smaller drug awareness campaigns dont always take the harsh approach of the NDC either. However, I feel showing the youth the more daunting facts of drugs first will grab their audiences attention and keep it, which is what they need to do to portray their message.In order to measure the feedback of the advertising campaign, the NDC would need to test the audiences reactions after viewing it. There are several ways of evaluating whether or not the campaign is effective. NDC could check up on the audiences campaign awareness and reach by testing campaign intuition and recall, credibility of the advertising for ecstasy, whether attitudes and behaviors in relation to illicit drugs has changed, and if people start getting more informed and abstain from drug use. Past campaigns have resulted in high outcomes for effectiveness. For example, in the previous campaign in 2010, 70% of ecstasy users and 44% of young people said they had recently seen, read or heard advertising about illicit drugs (National Drug Campaign). Since the creative strategy for advertising is being used from previous campaigns, these results could be a reflection for the current campaign effectiveness results. Since this campaign is an improvement on the previous one, we can hopefully expect even better results, especially since the current one has more of a focus on ecstasy users.Unfortunately, there are still some setbacks to the current campaign. There are no actual television commercials for the campaign. Though they may have radio flaws and some online videos, NDC has underestimated the influence of television. A small glance at a poster, or a 20 second radio spot may not be enough to capture to attention of someone, if looked at just once. Fortunately, this problem has been moderated due to the saturation of posters and outdoor advertising of the NDC. This way, if the poster didnt catch someones eye once, seeing it several times will cause them to actually read it. Though the NDC has not put money into television spots, they did allocate their marketing to enough outdoor advertising to make up for this.Though we may not be able to measure the post-campaign evaluations yet, since the campaign has only just come out, we could still critique what NBC has done so far. The two advertisements that have been their main focus both appeal to the audiences emotions and fears. I think this is an appropriate approach because showing the audience appalling facts about drugs will alert them into abstaining from them. Sometimes messages need to be harsh, especially to the youth, to stuff them from using drugs. Also, since the government and the National Drug Campaign is a reasonable source, the audience will be able to trust the messages that they are seeing. I feel this campaign will really make a fight to NDCs target market. The exposure to this campaign will help NDC in comer their objectives.,http//www.nationaldrugstrategy.gov.au/ cyberspace/drugstrategy/publishing.nsf/Content/17B917608C1969ABCA257317001A72D4/$File/mono-63.pdf.http//www.wa.liberal.org.au/item/3681http//www.thenewspaperworks.com.au/go/news/-ecstasy-face-facts-press-adhttp//www.health.gov.au/internet/drugs/publishing.nsf/content/news-7feb11-ecstasyhttp//www.tanglewood.net/projects/teachertraining/Book_of_Readings/Dusenbury.pdf
Saturday, March 30, 2019
Comparison of Techniques for Diagnosis of Multiple Sclerosis
Comparison of Techniques for Diagnosis of ninefold SclerosisBackground There is increased need to develop circumstantial biomarkers for multiple sclerosis (MS) to aid in the diagnosis, improve the management of patients and the monitor of the effectiveness of preaching. Oligoadenylate synthetase 1 (OAS1) is up regulated by type 1 interferon. A single nucleotide polymorphism (SNP) in exon 7 of OAS1 results in differential enzyme activity. Objective To correlate different OAS1 genotypes, in patients with backsliding remitting multiple scleroses (RRMS) chthonic interferon-beta (IFN ) therapy, with malady activity. Subjects and Methods OAS1 genotype was assessed in 20 patients with RRMS and 20 age and gender matched healthy controls. All patients were medicated with IFN . The patients were subdivided in terms of ailment activity assessed by Expanded Disability Status outstrip (EDSS), in two assemblages group I with tokenish distemper activity and group II with severely active disease. All patients were followed up every 6 months for a period of 2 geezerhood. Results Genotyping analysis of the OAS1 gene revealed a profound difference between RRMS patients and control group, with lower frequency of GG in patients (25%) compared to controls (65 %) (p = 0.0001). Furthermore, AA genotype was detected 35% of patients compared to 0% in controls (p = 0.01). Regarding disease activity, AA genotype had a signifi flowerpottly higher frequency (71.4%) in patients with severely active disease compared to 15.4% in patients with minimally active disease (p=0.0001). Conclusions The A-allele is considered risky and the G is protective, so those with the AA genotype in particular should be carefully monitored for evidence of disease activity. Conversely, GG genotype may protect against increased disease activity.Introduction four-fold sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system, the etiology and pathogenesis of which anticipat e largely elusive. The most common shape of MS is the relapsingremitting form (RRMS), in which episodes of acute worsening of neurological function ( lapsings) are followed by partial or complete recovery periods (remissions) free of disease progression.1,2 example 1 interferons (IFNs) are innate immune cytokins that activate the JAK/Stat intercommunicate pathway leading to induction of IFN-stimulated genes. The 2,5-OAS family is central to the IFN antiviral pathway for viruses whose paying back includes production of double-stranded RNA. One member of this family of proteins, OAS1, induces RNAseL, resulting in degradation of viral RNA, ban of virus replication, and promotion of cellular apoptosis.1Several OAS1 polymorphisms have been reported unitary located at the exon 7 splice-acceptor site results in alternating(a) splicing of the OAS1 mRNA. Although clinical trials have proven the efficacy of interferon-beta (IFN ) in the treatment of RRMS2-4, over one-third of patients h ave continuing significant disease activity.5 On purely clinical grounds, patients have variously been considered to have responded poorly, based on relapse occurrence6-9 or on deterioration progression while receiving IFN therapy.10 Therefore, cohorts of patients receiving IFN can be informative for evaluating general determinants of disease activity.Aim of work to poke into the relationship between OAS1 genotype and indices of disease activity in RRMS under IFN therapy.Subjects and MethodsTwenty patients with RRMS according to revised McDonald criteria11 were enrolled from an outpatient and inpatient population attending neurology Department, Tanta University Hospital. Twenty unrelated age- and gender-matched volunteers, with no history of MS or opposite neurologic disease, were recruited as a control group. All patients received IFN therapy and followed up every 6 months over a period of 2 years from January 2010 to January 2012. The Ethics Committee of Hospital approved t he study, and a written inform consent was obtained from each participant.For all patients, baseline data collected include disease duration, age at onset, relapse history prior to therapy, and clinical disability measured using the Expanded Disability Status Scale (EDSS).12 Relapses were defined as an episode of neurologic disturbance lasting for at least 24 hours and not caused by a change in core body temperature or infection.13 Disability progression was defined as an increase in EDSS score by 1 point from baseline confirmed at 6 months.5Genomic DNA was isolated from peripheral note samples. Primers were designed to specifically amplify a 347-bp product surrounding the rs10774671 SNP. A total of 5 grams of genomic DNA was amplified by PCR. Primer sequences used were rs 10774671 forward, TCCAGATGGCATGTCACAGT and reverse, AGAAGGCCAGGAGTCAGGA. enlargement conditions included initial denaturation at 94 centigrade for 2 minutes, followed by 28 cycles at 94 centigrade for 20 secon ds, 62 centigrade for 40 seconds 72 centigrade for 30 seconds, with a final extension for 7 minutes at 72 centigrade. The PCR products were digested with the ALU1 restriction enzyme. Digested products were analyzed by agrose gel electrophoresis and genotypes were assigned, the A-allele coding for a truncated form with low activity and the G conferring high enzymatic activity.Patients were assigned to 1 of 2 groups. Group I included minimal disease activity patients who experienced a maximum of 1 relapse after 24 months of IFN therapy and had no sustained disability progression. Group II included a severely active disease patients who had 2 or more relapses on IFN therapy over 24 months with or without sustained disability progression.14Statistical AnalysisSPSS 10 was used for data analysis.15 P place
Friday, March 29, 2019
Literature Review Of Companies And Supermarkets
books Review Of Companies And Super grocery storesAs companies/supermarkets contrive race to introduced technology that enables the guests to bring down help on their own (Bitner, M. Amy, L. Ostrom and Matthew, L. 2002). Growing number of nodes interacted with the technology to require good bug forces instead with a serving hard employee (Matthew, L. Amy, L. Ostrom, Robert, I. And Bitner, M. July 2000). The general affect exercise is base on the consumers feelings toward the phthisis of technology (Pratibha A. and Dabholkar 1996). The Supermarkets which introduce self-service check mark corpses wish to gain rapid acceptance and usage of these technologies by potential difference consumers. (Jungki, L. and Alla way of bread and butter, A. 2002)According to Merriam-Websters Dictionary (2008), Innovation is a modern idea, method or device, or the introduction of roughthing refreshing.Drejer (2002) argues that renewing is much than only if invention, that idea atomic number 50 non be innovative as a pure, it must(prenominal) be put in practice and be commercialized otherwise it is in either movement earlier to chat of vicissitude. Blackmon (1996) provide us with the best summary for a context of this seek expert reposition is habitd to describe interpolates in fill outledge that add-on the volume of getup or allow a qualitatively spiffing output from a given amount of resources and then in driveway organizational evolution The gross sales profit is a simple apprehensionual type concatenation to linking with the employee felicity as well as node gratification and financial work outance. This sales profit mountain range is the relationships between employee and node triumph (Gary, W. and Loveman, 1998). The expediency of the node retention and delight has been characterized by employ the re barter for objective or a factor score of quite an a few measuring sticks repurchase goal, and price tolerance. So that the consumption to office the guests forethought strategy that is the based on managing or so(prenominal) enjoyment and benefit of client retention (Narayandas, D. 1998). instruction execution transmitation and the actual operation dupe major signifi potfulce in the Evaluation surgical operation, as we command to retard the dimension of proceeds and service functioning. Most nodes do non surpass from satisfied seller to their competitors, but, there argon several factors that could affect client behaviour to switch to polar service provider such(prenominal) as mistake in core service failure, service encounter failures, uncertain prices, in devisal, responsive to service failures, attraction by competitors, ethical behaviours and involuntary shift etc. (Hawkins, Best and C championy, 2004). retailers need to analyze what makes a new return from the point of view by the client if guests facing problems understanding the argue behind the introductio n of new self-service checkout systems (SSC) they go out non use the system. As we launch new self-service systems, we need to crush the consumer behaviour as well. The consumer should be involved in some way or another at roughly degrees in the introduction of self-service checkout system. E precise retail or sales companies should take dish out of client wants and need (Wright, R. 2006).Consumers feel a sense of pleasure in understanding that they confirm appoint a unique store that they chiffonier, and do, frequent. This prompt is suggested on the notion of measure as a function of both worth (Oliver, 1999) and scarcity. People feel good when they find something of worth that is not easily available the feel good feeling from the ordinary and the mundane, is antithetic from cheer in that it consists qualitative rigs such as economic consumption and happiness. In contract, expiation is an evaluative judgment (Oliver, 1997) and to a greater extent cognitive in nat ure (Howard and Sheth, 1969).Satisfaction merchantman be defined as a cognitive evaluation resulting from the fulfilment expectations. Satisfaction is a judgment based on either a cognitive or emotional appraisal, make by the customer whether his or her expectations were met (Oliver, 1997). Positive affect is a grateful emotional response (Bogozzi, Gopinath, and Nyer, 1999).If organizations want to consider total customer experience, comfort by itself is a weak measurement (Barlow and Maul, 2000)As a result, when a consumer experiences more oppositeiation measure out in the store, consumer will be more comparablely to feel more dictatorial responses toward the store (Holbrook and Hirschman, 1982)The literature in retailing and customer behaviour has identified commitment as ones pauperization to watch over a relationship with the retailer (Bendapudi and Berry, 1997 and Fournier, 1998).The self-service checkout system (SSC) into the service come across necessitates research to correctd understand customers attitudes toward lapse providers and technologies, and their intentions to employ technology-based facility deli genuinely systems. In this research, the authors build up and experimentation three structural flummoxs that include a pecking instruct of consumer attitudes toward together the psycho system of system of logical and the technological factors of the come across to better appreciate their intentions to utilize self-importance Service Technologies. The result fences that intentions to exercise self-service technologies options be ambitious by manifold, hierarchical attitudes. In calculation to the trail be abundantings of attitudes toward exact self-service technologies and individual employees, the findings corroborate that high direct worldwide attitudes toward service technologies stuff intentions to use self-service technologies. fascinatingly, the findings indicate that heavy self-service technologies users depone more on at titudes toward specific self-service technologies than do light self-service technologies users, who rely more heavily on universal attitudes toward self-service technologies when formative intention to utilize an self-service technologies. (James, M. Matthew, L. Meuter and Carol, F. 2003)Kano Model AnalysisThe customer contentment type from professor Kano is a merchandising and quality management approach that can be employ for assessing and establishing customer rejoicing and happiness. Kano gravel has six categories of customer quality characteristics, but, only the first three specially relate to customer rapture. (Kano, 2007)These factors beBasic factors irritation factorsPerformance factorsBasic factorsThe prerequi spot factors that will cause dissatisfaction if they atomic number 18 not met, but, do not establish customer satisfaction. If they are fulfilled or cross expectations customer regard this as essential and basic factors digest to market entrance thresholdEx citement factorsThese requirements if they are met can increase customer level satisfaction, but, if they do not get together the requirements, do not cause customer dissatisfaction. These factors come to customers as surprise and create satisfaction. A political party can come out from crowd from competitors in a positive way using these factors.Performance factorsThese factors are concerned with the performance level. So, we can conclude that customer satisfaction is right off connect to the performance level, if the performance level is high, then, customer satisfaction will be met, but, if the performance level is low, cause dissatisfaction. These factors are right off related to customer desires, wants and needs etc. So, company should try to be matched in a market.(Adapted from Prof. Kano, 1994) guest point of view in relation to ego Service Checkout System (SSC)Researcher predict slightly(predicate) the adaptation of the self service checkout system have been gone a gainst the past recommendation, instead, customers are using this technology more and borrow this technology with open arms.Reasons for Supermarket to adopt this technology guests do prefer to use their bank cards in privacy and anonymity.Queue awaiting time decrementNeed for self-serviceQuick paymentShoppers feel empoweredRetail market is shifting towards radio frequency identification which will substitute the bar code.However this might be a foundation for modification magnitude working hours, as supermarkets not forecasting on a cashier. Due it is not many research have been done in the UK the USA get along might be relevant for this research and will be in future referred as a compare base.Theoretical manakinPorters competitive receipts possibleness is a classical and one of the foundational in trading literature, however lately it was criticized by some authors (Day and Wensley, 1988 and Hunt and Morgan, 1995). Therefore some complementary concepts have been suggest ed.In range to reinforce research the Porters take to be-chain theory was complemented with the more current Value-Network good example of Stabell and Fjeldstad (Stabell and Fjeldstad, 1998). Value-chain theory and the pry network model are presenting the dissimilar activities of a company where value can be configured and added through SSC systems. This model allows the researchers to investigate the diametric activities of companies on which the slaying of technology-based self-service as an innovation can have an effect.Theoretical Framework ImplicationIn order to fully understand the impact of introducing SSC in ASDA supermarkets it is demand to look into role and importance of innovation in a business context, product life cycle connected to SSC competitive reinforcement theory and complementary concepts, value chain theory, and utmostly the importance of customer relationship management in the new self-service economy.Innovation in advance we are going to analyze stag e it is important to understand what innovation in business context is. The full understanding can be obtained through definition of the term.According to Merriam-Websters Dictionary (2008), Innovation is a new idea, method or device, or the introduction of something new.Drejer (2002) argues that innovation is more than just invention, that idea cannot be innovative as a pure, it must be put in practice and be commercialized otherwise it is too earlier to speak of innovation.Blackmon (1996) provide us with the best summary for a context of this research technological change is used to describe changes in knowledge that increase the volume of output or allow a qualitatively superior output from a given amount of resources and thus in driving organizational evolution In the following relation, the innovation in a business context is a product, device, service, programme, service provider, or methods of services deli rattling that are new, unusual, or in other ways different from th ose previously used and positively reflects in boilers suit output of the organization in form of added value immediately to the organization or its customers. In the case of this research, innovation in form of SSC brings changes into service delivery.In order to understand the impact of the innovation it is necessary to understand to which theatre of service delivery it related.Dabholkar (2003) made a classification of technology in service delivery with three dimensions.By whom the service is delivered and who operates the technology.Where the service is delivered (at the give away or in customers kin) and how the service is delivered.Depending on which category the service belongs to different factors will affect the customers evaluation of the service quality. This classification can be useful in guiding companies in the development of their marketing strategies when implementing SSC systems. shelveAt service siteAt customers placeDirect strive customer goes to service si te and performs service using technology at service site. E.g. ATM, self-service at retail checkouts.Customer uses technology from home/office to perform service. E.g. internet shopping.Indirect cope withCustomer goes to service site and uses automated telephone system to perform service. E.g. automated wake-up calls atHotels.Customer calls automated telephone service from home/office to perform service. E.g. automated ticket-ordering over telephone.Source Dabholkar, 1994 in Anselmsson, 2001, page 13.Shadowed booth is the relevant technology for this research. Using this type of SSC, the customer goes to the service site and performs the service by using the technology provided at the service site. This implies a greater importance and wider range of quality issues in the interactive marketing function of the organisation.Product/service life CycleIn a business context everything is going through different level, stages of performance. It is similar to the any life development. Fr om the cell of life to the maturity and death, the products are repeating resembling way from idea to implementation and ultimately death. Particularly in our case the service as well as product must be planned and introduce to employees, customers and eventually be accepted by them. It is of import for the managers to adjust and control its performance while it goes through different stages. The effect respectively will be also different on different stages. Therefore, considering the life cycle of SSC systems is important when investigating the cause on company competitiveness.Figure Source Cordiant Technologies LimitedThe product life cycle incline to go through the flipper stages of productsService/product development marketplace introductionGrowth stageMature stage comprise of decline. separately stage is different in effectiveness of the product, expenses, revenue, etc. The first stage usually money intensive as there is no sales revenue and all expenses are covered by di fferent organizations activities, in our case no effectiveness gain from reducing cost of operation. Stage two is quite expensive in our case as technological cost is very high. The purchase of the machineries and shops infrastructure adjustments to accommodate it are required. except the staff and customers trainings and special promotions materials must be prepared. The third stage is endless use of SSC by customers and therefore operational cost reduction produces positive revenue, which might cover the marketing expenses. The fourth stage is characterised by very low costs of operation as number of customers who is using it change magnitude. The final stage might come as soon as more efficient and productive technology will arrive and current become outdated. (Day, 1981)The progression of a product through these stages is not certain however. just about products may stay in the mature stage forever, for drill commodities such as milk, others might not even rich stage of ma turity.These products go through their life cycle as marketers marketing mix strategies change. For example, advertise is informative stage of the introduction, maturity stages, winning in the growth and in the decline stage reminder-oriented. In the early stages the promotional budget tends to be highest, and as the product gradually taper off matures and decline. Product characteristics, pricing, dispersal also tend to change.(Day, 1981)The concept of product life cycle, applied to Self Service Checkout System (SSC) innovations, has also been introduced as an important concept that also contributes to affecting competitiveness.The Value-ChainPorters value chain framework today equable is the accepted language for agreeing and analyzing the logic of starchy-level value creation, and is also a framework for analyzing sloshed-level competitive strengths and weaknesses.In value chain analysis competitive advantage is understood by these discrete activities of the value creation process that contribute to the firms relation cost place and produce a basis for segregation. These activities are the building blocks from which a product or process is created that is of import to the firms customers. The different activities have different economics and thus contribute differently to the valuable characteristics of the product or process.The value creating activities in Porters model are shared out in two levels. Primary activities consist of directly interact to create and bring value to the customer, while support activities facilitate and develop the performance of the primary activities.Figure Source (Porter, 1985, 1990)The primary occupation level consists of five actions inbound logistics, operations, outbound logistics, promotion and sales and service. The principal(prenominal)tain actions are procurement, technology growth, human supply management, and firm infrastructure. It is important to note that the different activity categories are not the same as organizational functions. Using the value chain for analysis, costs and assets are assigned to the value activities as a first step, and are progress analyzed as structural drivers related to the scale and scope of the firm, linkages across activities, and environmental factors. Cost and value drivers are usually analyzed separately. Moreover, drivers are partly related to inside relationships, partly to external factors, and partly to relationships between internal and external factors as well. The main drivers of value are policy decisions made by product and particle choices when the firm is established or repositioned.(Stabell and Fjeldstad, 1998)According to Porter, the value-creating logic of his value chain with its generic wine activity categories is valid for firms in all industries. However, he further states that the specific activities that are vital to a firms competitive advantage depend on which industry the firm operates.(Porter, 1985, 1990)Stabell and Fjeld stad (1998) however have investigated the application of the value chain model to a variety of industries and have experienced problems in applying the value chain frame work to more than two-dozen firms.They have found that the value chain is suitable for describing and understanding the value creation logic of manufacturing firms, but that it proves problematic when analyzing activities in service industry firms.They argue that problems gussy up from difficulty to assign and analyze activities in terms of the five generic primary value chain categories proposed by Porter, leading to unclear explanations of value creation.Therefore, Stabell and Fjeldstad (1998) suggest that the value chain can be considered as one of three generic value configurations to facilitate the understanding and analysis of firm-level value-creation logic for a broad range of industries and firms. The additional two value models anyways the value-chain are the value network and the value shop. The importa nce shop model applies to firms where price is created by mobilizing income and performance to resolve an exacting customer difficulty, for example professional service firms dealing with medicine, law, architecture and engineering. The value network model refers to firms that generate cost by facilitating an organization relationship among their customers using a mediator technology.Stabell and Fjeldstad (1998) also propose alternative presentation formats for both models that represent their unique value creation logic. For the purpose of this research both Porters value chain and Stabell and Fjeldstads value network is of importance. Although Stabell and Fjeldstad state that according to their findings the value chain is mostly useful for manufacturing firms, for our investigation of supermarkets traditional operations, the value chain is most fitting, with one small alteration.However, in also considering the introduction of a new type of service offering through technology-base d self-service checkouts, it is found necessary to complement the value chain model with the value network model in order to be able to capture the value adding activities of SSC. The combination of the different value-creating logics, as suggested for this research, has also been proposed by Norman and Ramirez (1993). Since the main purpose of the research is to investigate the effects of SSC in supermarkets, the value network is of cardinal importance, which is discussed in further detail below.The Value NetworkValue networks use a mediating technology to link clients and customers who wish to be interdependent. According to Stabell and Fjeldstad (1998), the firm provides a networking service through the mediating technology and thus facilitates reciprocation relationships among customers distributed in space and time. For the consideration of SSC, the value network idea is modified to remember that the firm is the network itself, linking its customers not to each other but to the firm itself, facilitating a more interdependent exchange relationship between the firm and its customers.Customer SatisfactionTo measure the customer satisfaction of how your organisations total product performs in relation to a set of customer requirements. (Gower, 1999)If you like to measure the customer satisfaction of the customers and you need direction barely what you are measuring. Understanding the concept of customer satisfaction is very on the loose(p) and can be done by assuming yourself as a customer in a supermarket.Satisfaction is simple. If you get what you wanted and your requirements are met, you are satisfied. The starting point of a customer satisfaction management is to set the objectives.There are different customer satisfaction objectives that can be set.Customers requirements (important ratings)Customer satisfaction (Satisfaction ratings)Comparison with other organizationsPFIs (priorities for improvement)Customer satisfaction indexA track able measure o f satisfactionThe internal perspectiveFirstly, you should identify customers requirements and there are many things customers want and need but we need to identify most relative of customer requirements.Secondly, you must measure customer satisfaction. Organisational performance is directly related to customer satisfaction and list of customers requirements.Thirdly, if you could go a bit further to analyse the customers requirements as compared to other same organisations. (In our example supermarket) This will give you the opportunity to get the benchmarking. By using benchmarking, you could analyse the requirements of your supermarket customers as satisfied or not satisfied.Fourthly, after get the customers satisfaction measures, you can use these measures to produce some survey outcomes and the first of that step is to identify the PFIs (Priorities for improvement)Fifth, you will need to measure the overall customers satisfaction. We call it a satisfaction index and it will indi cate us to monitor progress from the one year to the next for the overall customers satisfaction.Finally, customers satisfaction survey has to be done inside the supermarket to know about the understanding of employees about their customers requirements. It will help any supermarket to indentify that if their employees know about their customers requirements and can indentify gaps. An internal survey can also be used to help the management to make the decision making process and strategical management. (Gower, 1999)Achieving Customer SatisfactionCustomer satisfaction is measured frequently. Sampling is extensive. Surveys are quantitative as well as qualitative. The measures are taken very seriously. They are reviewed unfailingly by Top management the development of such measures is taken very seriously as the development of budgetary measures or product reliability measures. Evaluation of people in all functions at all levels is significantly affected by the satisfaction measures. (Tom Peter, a animosity for Excellence)Customer delight seems very credible people say things likeIn todays competitive markets customer satisfaction is no longer enough you have to delight the customers, give them something they did not expect to keep their business.In customer satisfaction, the link between customer the true, customer retention and profitability can make get better customer satisfaction. It has been shown that customer retention can boost profit of the supermarket as it is very easy to keep the existing customers than getting new customers.After getting the trend data and established the satisfaction- loyalty ratio in your market for your organisation, you make some models. Some companies now have business performance models based on their customer satisfaction management survey results that have quantified the exact links between customer satisfaction, customer loyalty, sales and profit. They know that how much one percent improvement in customer satisfaction w ill improve loyalty how much that contributes to profits. Precisely, this is a very flop forecasting tool.Customer satisfactionBusiness successEmployee satisfactionCustomer RetentionFigure (Ch. BABAR 2010)Customer Satisfaction and the PerformanceCustomer satisfaction can be defined as more loyal customer and it involves emotional and complicated process. Every customer has certain level of product or service expectation and desire. If customer expectation level increased as a result of using that product or service, then, customer experiences satisfaction.(Simon Homburg 1998, Page 44)However, Satisfaction has also latterly been described as the emotional reaction to this cognitively defined process of comparison.(Homburg and Rudolph 1995, page 31)In this context, customer experiences that the outcome of the process of comparison will not of all time give the correct result about the expected satisfaction outcome and actual level of satisfaction outcome. Instead, direct effect of these outcomes or satisfaction levels also interacts with satisfaction.(Bolton et al. 1991 page 376)The customer satisfaction has been in research for long time, mostly research and investigation has been done on the customer satisfaction, but, not on the customer retention.It is the experience and attitude of the employee in closest contact with customers that customers are satisfied, loyal and customer retention has been achieved.The Satisfaction is an a overall attitude of customer towards the service provider(Levesque and McDougall, 1996)The companies are more successful, afterwards research has showed if they adopt customer retention rather than customer satisfaction.(Knox, 1998)Customer satisfaction brings many benefits. Satisfied customers are fewer prices sensitive they purchase more items, not go to competitors and stay longer.(Zineldin, 2000)Customer satisfaction is directly related with the customer complaint process management. If customer complains more, then, it incre ases more customer satisfaction. Customer complains about the product or service he/she receives, then, supermarket can achieve more customer satisfaction(Johnston, 2001)The product innovations, staff service, price, convenience and business profile are all determinants of customer satisfaction.(Athanassopoulos, 2000)Later, Bejou et al. (1998) propose that customer satisfaction can be enhanced through relationships, provided they are true and managed to the customers satisfactionCustomer retention is not directly related with the customer satisfaction.Sometime customer do not change service provider because of the alternative circumstances, but, customer satisfaction level inhabit the same. Sometime customers do not have any choice to change their service provider, so, they stick with their existing provider.Hallowell (1996) argues that customer satisfaction cannot produce life time customer loyalty even though customer satisfaction has been increased, but, retention can be relate d with customer satisfaction.Retention can be understandable as to do business or exchange a commitment to continue with a particular company on an ongoing basis.(Zineldin, 2000)Retaining old customers are easy and cheap to keep as compared to the new customers because they are more loyal and less price sensitive. They keep their loyalty to their existing service provider and do not change their loyalty to the new service provider. It increases customer retention, satisfaction, lower price sensitivity, higher market share, higher productivity and higher efficiencies.(Reichheld, 1995)The authors suggest that in order to retain customers, companies should always change and developing their product and services to meet the ever changing needs of customers.The concept of acquiring, developing and retaining customers from a cognitive and affective perspective, they provide examples of how cognitive and affects are used to increase retention.(Desai and Mahajan, 1998)Customer satisfaction is a direct determining factor in customer loyalty, which, in turn, is a main presentation of customer retention.(Gerpott et al., 2001)Customer satisfaction can be achieved by customer retention. Customer complaint process can increase the level of customer satisfaction that result in customer retention. Employee perspective is also very important with relation of the customers. individual relationship with the customer can boost the level of customer satisfaction. It is direct related with the mental theories of customer and employee perspectives. Managers should be aware of customer wants and needs as well as employee mental perspective. Different employees keep different level of relationship with the customers that could affect the customer satisfaction and retention level. Therefore, Managers must keep eye into employee/customer relationship and set realistic goals to achieve.(Spreng et al, 1995) steady-going sectionCustomer RetentionCustomer retention is directly linked with the customer satisfaction. The framework guide managers to decide which part of customer satisfaction has more collision, which part of customer satisfaction needs to be improve and make strategies to retain existing customers.An individual level model of loyalty and customer retention has been developed, that can be used to predict effects of service level improvement at supermarket.Customer satisfaction has been changed recently from transactional marketing to relationship marketing.(Grnroos, Sheth and Parvatiyar, 1994)To all marketing activities directed toward establishing, developing, and maintaining successful relative exchanges(Morgan and Hunt, 1994)Customer satisfaction has been treated as essential instrument for the customer retention, has gained significant importance in relational marketing approaches.(Rust and Zahorik, 1993)Kotler sums this up when he statesThe key to customer retention is customer satisfaction(Ko
Creative Writing Example- Cinderella Story
Creative Writing Example- Cinderella Story maiden act(After bugger off death, Cinderellas paternity did his second marriage. She has dickens daughters.) find My pricy little daughter. nowadays thiss your pro foregather off and these atomic number 18 your babes. Go . Get accredit them.(While smiling)Cinderella al rightfulness father(She was blithely went begin near her siss and said, lets sh atomic number 18 my room al wholeness of us. She took them off the deliver showing them love) induce (While calculateing his new wife)I do anticipate that you will love and busy con cheekr of my daughter akin your suffer daughter. I grew up her the alikes of a flower. So, amuse jam c be of her after I leave. You understand?(She was smiling like make believing) footstep M new(prenominal) O key, at iodin time I devote non 2 but two childrenIll retire c ar of them, you.(To herself)Well lest bet that after you leave, because Im the ace who ruling the house. flumm ox-Well, so Im believing in you.My ripe Cinderella.(Cinderella entering to the coif with her two babys from left side.)Cinderella Yes.. cause..Father My costly Im departure now. Itll take pull down a matchless month to pay underpin sticker home. Be hot with your step add and childs till I receive. okey..Cinderella (With a pompous smile)Okay fatherTake care of yourself and recognise backside soon.(After shortly silent of item) footf any Mother- ( come nigh Cinderella and put her arm around her)Oh. estimable why are you crying..? wear thint cry..now we are present(predicate) for you. Hell be back soon.(Cinderella smiled bit)Father (come nearby Cinderella and touched her indicate)Then, Im leaving. Please take care(After short silent, hes leaving stage from right side)(Two babys were sitting on a bench, on stage) aged babe Hey. Cinderella tolerable of crying. Now come here Do and set off our things properly. You understand? issue babe Yes, after that set ashore us afternoon tea.(Even that Cinderella was silent at the right Conner on the stage)Elder sister (Got up from the bench and come near Cinderella and Pulled from her shoulder)Cant you hear..? Go do what I said.(She was stressful to leave the stage with piteousness) stones throw make (To Cinderella) Hold it Cant you hear Cinderella.(Came near her and..)We are non hear to pet you Keep it in your take care. Do what we are heavy and dont let us re judicial decision you twice. commiserate?Cinderella- ( Slowly waved her head) ill-treat Mother- Okay.. Now go bring tea for us. Go..(Cinderella leaving the stage silently) footstep Mother- ( drama to her daughters and.. ) We should not pet this lass.Elder infant- Yes Yes She opines shes a princess.Hmmm. junior Sister- reveal us father. Arent we moderately than her..? stones throw Mother- Why not. You two my daughters are the pretty ones.(After short silent)Cinderella. Where are the tea? What are the tea? What are you doing turn up in that respect.. Still stressful to pet by us?(Cinderella enters the stage with the tea)Step Mother- Where have you been lass? What take this long to prepare tea? Now hurry up(Cinderella slowly preparing tea. And a division raised from back stage from back stage)A invitation from magnificent prince for every the four-year-old women for g totallyant ball ceremony. Today evening at the royal palace, all the teenage women are welcome by the PrinceStep mother- Hear that? younger sister- yes yes mother.. Can we twain overly apprise go.. Isnt it..?Step Mother- Yes why not You both likewise prettiest ones.lets go.Prepared from separately one of yours best cloths.. Go prepare for the eve..(Two daughters happily run away from stage)Cinderella- I also like to be at that place Can I go also go the Evening.?Step Mother- What.? What for you are going? Hm.Do you recollecting that youre pretty to be in that location..? See..You case like servant oh and you are on e of.. at this place.Cinderella- Please mother let me goStep Mother- No. Youre not going anywhere(She pulled Cinderella showing her ill pot and left the stage)(Cinderella alone at the stage and crying. dropped complicate to the stage..end of the first act)second act(Back build of a room. One side there is a fertilisation table and two sisters in front of it. They are preparing for the ceremony. Their mother part them. Cinderella was expression at them distressingly)Elder sister- Mother how is my hair Do you think it enough that I put flowers on my hair?Step mother- No Its enough.. here.. Put same more powder to your face. junior sister- (loudly) Mother. there is a one broken thread come out from my frock.please take it off.Step mamma- Cinderellawhat are you doing.. Dont you have any other work except staring at us. come here and help this child.(Cinderella was silent for a while and come near here younger sister and cut the thread.)Elder sis- Cinderella.. Where are my slippe rs. Where.?(She was silent)Where.? Where you kept it? Go. find it I think its in cuberd.(There is coberd corner of the stage, she went there and took those apparel and gave it to his sister.)Elder sis- ohh. It is dirty. cant you seeclean it properly.(She is silently doing the work.) younger sis- Tell me.how do I lookAm I pretty?Step mom- YesYou both are pretty my dear daughters. junior sis- (while looking at at the mirror)Mother. Do you think that prince will like us?Elder sis- (With angry face)No. prince will like meisnt it mother Myself pretty than her.Isnt it motherYounger sis- (Giving a hit to her sisters solder)No. I think I am.Step mom- O kay enough enough. Both of you look pretty Prince will like both of you.(Three of them are fashion their selves. In a dark corner of stage, Cinderella was watching them.)Step mom- pelt along little girls. Time to goElder sis- Wait Wait Younger sis Oh lord Wait..Step mom see coach came come hurry up lets go(She led her daughters to the coach. They are leaving the stage. Cinderella was sad and looking around)Cinderella (Its seems shes sad)Oh I wish that I can be there.(Cinderella is crying. short the fairy godmother appears to the stage with smoke) graven imagemother Oh my dearwhy look very sad..Cinderella who are you?Godmother (came nearby Cinderella)I came here to help youTell me.. Why you look sad?Cinderella There is a Royal Ball at the royal palace..All the young ladies are going.. (She is thinking)God mother SoCinderella So.. My sisters and step mother went there.. alone they did not allow me to come..Godmother-Who?Cinderella Step motherGodmother But why..?Cinderella (sadly)Shes express that Im ugly. And look like servant.Godmother (touched Cinderellas head.)Oh curt I know you are diligent. No Youre the prettiest among them. They just jealous of you. Now. You dont worryIll confide you to the ceremonyCinderella (Surprisely) What.? How?Godmother Can you bring one pumpkin from your garden..?Cinde rella A pumpkin.? Why.?Godmother express quickly will you.(Cinderella left the stage form right side and come back with the pumpkin.)Godmother Okkeep it from outside(a).Cinderella why is that?Godmother You do what I said dear(Cinderella took it away and kept outside. she left the stage from right side and came back to the stage.)Cinderella OkayBut why did you ask me to do that.?Godmother Just because.. (She was waving her magic staff)Cinderella (With wonder face)Oh my lordWowA coach wowIts wonderful. lots of horsesGodmother Thats for take you to the palaceCinderella-For me?Godmother Yes for you.Cinderella (Sadly)But. (looking at her dress)Godmother Why.?Cinderella My dress is not matching for this occasionGodmother Oh my I almost forgot wait(Again the fairy godmother waved her magic staff and places it into Cinderellas fall)Now lets go to your room come..(Cinderella left the stage from left side and again returned back after few minutes Now shes well-dressed prettil y)Cinderella (in astonishment happy face) Oh lord, what do I see?A Beautiful dress and enclothes for me you are so kind to me give thanks you.. Thank you very much.Its perfect for me Im so happyGodmother My pleasure dear Now hurry up bewitch into the coach they will take you to the Royal palace.(While Cinderella running to the coach)Godmother Oh wait my dearCinderella Why..? What is it?Godmother When its 12 o quantify you must be at home, dearCinderella But why ?Godmother other(a)wise your dress will disappear.Cinderella ( melodic theme a little and) Okay Now I got it..Its clear. Im leaving Thank you again for everything.Godmother Okay my dear enjoy the Evening(Cinderella ran away from the stage. Curtain drops. ratiocination of the second act)3rd act(At the fagots ball. The pantywaist and the King are opening the ball. The musicians are standing(a) behind them with the musical instruments in their hands. When they play and sing the melody chum salmon John the guests will leap a polonaise.)(Lots of young ladies including Cinderellas two sisters. They are waiting to move steps to the music)Prince look did you invite all the young women of our region to the Ball? see Yes my PrincePrince Do you think all of them came to the Ball today?Minister Yes my Prince I do believe(From the other side of the stage)Elder Sister Oh see the crown Prince..Younger Sister yes wow he looks fabulous isnt it?Elder Sister hmmm(Prince walk around the stage and all the young ladies difficult to take his attention)1 Young doll Oh my dear prince (Waved her hand to the prince)2 young Lady My prince give me a chance to dance with youElder Sister My prince Im the prettiest among them please take me(Rendering the royal horns to start the Royal Ball)Queen (solemnly) the ball is on please dance and play(All the young ladies assaying to approach the Prince)3 young Lady Oh my prince Please take me take me4 young Lady Prince Im the best one for you please choose me..5 young Lady My prince Ill do whatever you are ordering me to do please select meRoyal Announcer Listen Dont rush the prince. Prince will select one of you to dance. And the selected one will be the Princes spouse. Now calm down6 young Lady please select me my prince(While that one young lady fainted down)Elder sister My princes please, dance with me(Prince was laughing to himself)Prince ( on the QT) Minister, where did you find these ladies?Minister Oh hmm (speechless)(Music and dancing Suddenly Cinderella appears from a corner and the music kale.)Queen Who is that girl?King Oh. She looks Beautiful(Prince was bored finding a girl to dance and unawares Cinderella caught his eyes)Prince Minister who is she She looks charming so elegantMinister yes my terms Ask her to dance with you..Cinderella (to herself) Oh.. Its already begun(All the other young ladies are staring at Cinderella)Minister Welcome to the Royal Ball come join with usCinderella Oh Thank you very muc h I thought Im too late.(All the other young ladies are trying to approach the prince, but prince walk near Cinderella)Elder sister Where she came from?Younger sister (irritated) I dont know who is that?1 young Lady It seems prince going to select her2 young Lady Oh no(Prince was looking at Cinderella and she noticed that. She got blushed and turns her face to ground)Prince Dont be faint-hearted your fair face became blushed why? Dont you like to dance with me?Cinderella No nothing like thatPrince Then what is it?Cinderella (Turned her head to ground with shyly)1 Young Lady (Irritated) Shes too much shes giggling with the prince..2 Young Lady Yes shes trying to taming the princeElder sister Why the prince going to dance with her arent we also pretty?Younger sister true thatOther Young ladies (all buzzing together) hmmmPrince May I dance with you? What you say?(Cinderella silently gave her hand to the prince)Prince (with happy face) Lets start(The prince and Cinderella started dancing polonaise to the music. They are moving their steps to the melody, romantically Other Men, Women are also dancing to the music)Prince (looking at Cinderellas face) what is your puddle?Cinderella Cinderella.Prince Hmm its perfectly fits for such a pretty young woman like you Where do you live?Cinderella (shyly) in the same cityPrince -why are you shy? Dont look away (Prince moved her chin upwards) olfaction at me(She was very much blushed and again looked away)Elder sister Shes trying to own the prince1 Young Lady I think prince also set down into her witchy spellElder sister Where did this witch came from?2 young Lady But shes so prettyElder sister I dont think so3 young Lady You just jealous with herElder sister (Irritated) No She isnt pretty thats her witchy looks(The prince and Cinderella dancing perfectly to the music, also the prince trying to get Cinderellas eye contact, but shes tranquilize blushing)Prince You are a dream of my heart now(Music again, they dance. Suddenly the music stops again, they dance. Suddenly the clock strikes 12 times.)Cinderella Its 12 oclock and I have to run. Good-bye, I really had a great gaming(Her dress will disappear came to her mind Swiftly left prince hand and started to run impatiently.)Prince (Astonished face) Cinderella. What happened?(She was like nowhere and ran away from the stage didnt even answer the prince. While she was running dropped her one of shoes)Prince (to himself) I cannot figure out what happened to her why she left me(Al the guests are buzzing about what happened)Prince (falls on one knee) where have you run, the dream of my life?I want to dance with you all night(He picks up the lost shoe and looks at it. End of the leash act)4th act(Background of the Kings palace Prince was sitting on a chair, Cinderellas shoe in his hand. It seems hes still thinks about her)Minister Oh Look at this he looks very sad about that incident May be of that pretty lady (to himself) I s hould talk to himMy dear prince you didnt have your meals properly What happened to you? Why you look so sad?Prince (fetch a sigh) I want to find the possessor of this shoe CinderellaOh why she left me like thatMinister Oh My dear prince you fell in love with herPrince (in a low voice) yesMinister (to himself) hmmm So I have to find herPrince MinisterMinister Yes my dear pricePrince We have to find her Because shes the one who stole my heart.Minister But how.. My dear prince Therere thousands of girls in our region non only that there will be many girls named Cinderella Isnt it my dear princePrince But shes the one I need her It wont be that difficult. Lets tryMinister Hmmm.. (to himself) also wont be easyPrince (suddenly something came to princes mind) Minister Take this shoe to each and every house and check who fits it perfectly I think we can find her take her to meMinister Hmmm Okay my dear prince will try(Prince leaving the stage with lots of hopes and believabil ity in his face End of the Fourth act)5th act(Minister entering to the stage with his solders)Minister This is out(predicate) How it can be potential I think this prince is out of his mind But Ive to answer him And hes expecting a possible answer we searched half of the city(Turned to his solders)Weve no any other natural selection except searching more Lets goOne of solders Minister didnt search this part yetMinister Okay then lets search that way(The minister and solders are leaving the stage from Right side. Step mother and two sisters approaches to the stage)(The stepsisters and stepmother are talking. Cinderella is sitting aside, knitting something.)Elder sister Mother it was a fantastic evening everything was perfectYounger sister What use of thatStep mother WhyHow was the prince Heard that hes the handsomest young man in the countryYounger sister Yes he was I couldnt take my eye on him hes that belt alongElder sister I noticed that once he was looking at meYounger sister No way He didnt even notice you He smiled at meElder sister No he looked at me also(While the discussion Cinderella brought tea for them)Step mom Oh.. Tea.. Keep it here and leave(Cinderella gave them tea and went to a corner of the stage and sat down on a bench and started thinking)Step mother Tell me more what happened there?Younger sister What use of telling motherStep mother why what happened?Elder sister The prince was secretly looking at me but, suddenly one girl came into the Ball and washed-up everythingYounger sister His attention to me lost by that girls arrival (Sadly) But shes prettyElder sister Not that prettyYounger sister No she was the prettiest one among all of us So prince liked her in first sightStep mother What(It seems Cinderella is still thinking)Elder sister Yes mother Prince madly liked herYounger sister He didnt even look at us after her arrivalStep mother Then?Younger sister (sadly) He only danced with herElder sister Yes there were many good looking pretty ladies but he didnt even pay attention to them(Cinderella was looking at them)Elder sister Hey Cinderella what you are looking atYounger sister I think shes spy us listening to what we are talkingElder sister Hey come here tell us what were u doing?(Cinderella was silent and turned her head to ground)Cinderella NothingStep mother Listen.. Listen someone is calling from outsideElder and Younger sisters together Heralds from the Kings Palace Oh and FatherStepmother But where are these heralds going..?(Heralds, the minister with his two solders enter the room accompanied by Cinderellas father.)Minister Please, try on this glass shoe.(Looking through the long list) We know you were at the ball.Elder sister (trying the shoe on) oh Its too small. This isnt mineYounger sister Its small for me, too. What is the purpose of doing this?Father But look at my first daughter She has small feetHer name is Cinderella May be shell fit this..OCinderella Come here, my dear please take it and try it out will see whether it fits you or not..(Gives her the shoe Cinderella was little scared and surprised)Father Dont worry dearjust try it outStep mother But she didnt go to the ball. She is Cinderella and that is all I dont think that itll fit CinderellaMinister Lets see after she put itCinderella I want to try it on, Mother. Besides, Ive got another one of these(And suddenly she takes the other shoe out of the pocket in her apron)Elder sister You were that wonderful pretty lady, I see now only I got the pictureOh, Cinderella, pardon me.Younger sister And meStep mother And meFather I knew it I knew it that one day you will be gleaming among all of them Oh Cinderella Best wishes to you, my dear daughter.Cinderella Oh Father I love youFather My dear you made your mother proud Even may be I wasnt a perfect father for you Pardon me, too. I love you the most(Her father was crying and shading his tears)Father But what could I do?Cinderella N o dont say like that, father you were the only kindness to me dont worryI am so happy today. Dont cry father pleaseMinister Prince is desperately waiting for you dear youve to come with us nowCinderella I forgive all of you. I didnt mind anything. Good-bye father Good-bye all.. Ive to go nowMinister Be quick, lets go Hes dying(p) to see you.(All wave her good-bye. Cinderella leaves the room after the Minister and his two solders, also waving her hand.)The end.
Subscribe to:
Posts (Atom)